# Versie voor versie — Altijd in aanbouw — Vic Boomer

0.1: Is het idee het onderzoeken waard?. 0.5: Werkt het ook buiten het hoofd van de maker?. 0.9: Wat gaat nog fout?. 1.0: Is het goed genoeg om te gebruiken?. 1.1: Wat heeft het gebruik ons geleerd?

## Card

- **Number:** VIC-053
- **World:** VIC
- **Type:** knowledge-card
- **Language:** nl
- **ULID:** 01M1DY7XMRDRFJE8BWRT4F5CW7
- **DNA:** cgtgacttagctagaccttatacggagattaggtatgactaaacggaaccgttgatttcggcga
- **Canonical:** https://vicboomer.com/kaarten/altijd-in-aanbouw-step-2-cgtgacttagctagaccttatacggagattaggtatgactaaacggaaccgttgatttcggcga/
- **Verify:** https://vicboomer.com/kaarten/verify/?dna=cgtgacttagctagaccttatacggagattaggtatgactaaacggaaccgttgatttcggcga
- **Stack:** [Altijd in aanbouw](https://vicboomer.com/kaarten/altijd-in-aanbouw-catgtgctcttggcaaatgtattagattcgctggcggatcaaacggaaccgttgatttcggccc/)

## Presentation

version-table

## Comparison

| VERSIE | DE VRAAG |
| --- | --- |
| 0.1 | Is het idee het onderzoeken waard? |
| 0.5 | Werkt het ook buiten het hoofd van de maker? |
| 0.9 | Wat gaat nog fout? |
| 1.0 | Is het goed genoeg om te gebruiken? |
| 1.1 | Wat heeft het gebruik ons geleerd? |

## Body markdown

Inhoudskaart 2 van 3 uit de stapel **Altijd in aanbouw**.

## Relations

| type | id |
| --- | --- |
| topic | tp:systems |

## Representations

- **html:** https://vicboomer.com/kaarten/altijd-in-aanbouw-step-2-cgtgacttagctagaccttatacggagattaggtatgactaaacggaaccgttgatttcggcga/
- **markdown:** https://vicboomer.com/kaarten/altijd-in-aanbouw-step-2-cgtgacttagctagaccttatacggagattaggtatgactaaacggaaccgttgatttcggcga/card.md
- **machine_index:** https://vicboomer.com/llms.txt
- **print:** https://vicboomer.com/kaarten/altijd-in-aanbouw-step-2-cgtgacttagctagaccttatacggagattaggtatgactaaacggaaccgttgatttcggcga/werkkaart.pdf

The canonical HTML page and card.json are the authoritative representations.