# Het tarief — Huur Tom + AI in — Vic Boomer

Tarief: €1.000 per dag. Btw: Exclusief. Inbegrepen: LLM’s en coding agents. AI-toeslag: Geen afzonderlijke toeslag. Beschikbaarheid: Maximaal twee dagen per week. Afrekening: Je betaalt voor de dag. Je beoordeelt het resultaat.

## Card

- **Number:** VIC-038
- **World:** VIC
- **Type:** knowledge-card
- **Language:** nl
- **ULID:** 01M1C8RZT1GEGHJ6MKC42Q6WPA
- **DNA:** gaatggacacgcacgggcatcgacaaccctatctagtaggaaacggaaccgagatactttcaac
- **Canonical:** https://vicboomer.com/kaarten/huur-tom-plus-ai-rate-gaatggacacgcacgggcatcgacaaccctatctagtaggaaacggaaccgagatactttcaac/
- **Verify:** https://vicboomer.com/kaarten/verify/?dna=gaatggacacgcacgggcatcgacaaccctatctagtaggaaacggaaccgagatactttcaac
- **Stack:** [Huur Tom + AI in](https://vicboomer.com/kaarten/huur-tom-plus-ai-acgctcctaggtggcgttgccctcaaactctcatctgtgcaaacggaaccgactctgacagttc/)

## Presentation

fact-table

## Specifications

| label | value |
| --- | --- |
| Tarief | €1.000 per dag |
| Btw | Exclusief |
| Inbegrepen | LLM’s en coding agents |
| AI-toeslag | Geen afzonderlijke toeslag |
| Beschikbaarheid | Maximaal twee dagen per week |
| Afrekening | Je betaalt voor de dag. Je beoordeelt het resultaat. |

## Body markdown

Inhoudskaart 4 van 4 uit de stapel **Huur Tom + AI in**.

## Relations

| type | id |
| --- | --- |
| topic | tp:systems |

## Representations

- **html:** https://vicboomer.com/kaarten/huur-tom-plus-ai-rate-gaatggacacgcacgggcatcgacaaccctatctagtaggaaacggaaccgagatactttcaac/
- **markdown:** https://vicboomer.com/kaarten/huur-tom-plus-ai-rate-gaatggacacgcacgggcatcgacaaccctatctagtaggaaacggaaccgagatactttcaac/card.md
- **machine_index:** https://vicboomer.com/llms.txt
- **print:** https://vicboomer.com/kaarten/huur-tom-plus-ai-rate-gaatggacacgcacgggcatcgacaaccctatctagtaggaaacggaaccgagatactttcaac/werkkaart.pdf

The canonical HTML page and card.json are the authoritative representations.