# Drie besluiten — Vic to the Future — Vic Boomer

Iets nieuws beginnen zonder een besluit te nemen over bestaand werk is geen flexibiliteit. Het is alleen meer werk tegelijk. Een nieuw model is nieuws. Nog geen strategie.

## Card

- **Number:** VIC-044
- **World:** VIC
- **Type:** knowledge-card
- **Language:** nl
- **ULID:** 01M1DWKE0Q1Y887JYASN2S6JY0
- **DNA:** aattgcaagaattagttaggtatccaccgcatcagttaaaaaacggaaccgttagcgtgaacct
- **Canonical:** https://vicboomer.com/kaarten/vic-to-the-future-step-4-aattgcaagaattagttaggtatccaccgcatcagttaaaaaacggaaccgttagcgtgaacct/
- **Verify:** https://vicboomer.com/kaarten/verify/?dna=aattgcaagaattagttaggtatccaccgcatcagttaaaaaacggaaccgttagcgtgaacct
- **Stack:** [Vic to the Future](https://vicboomer.com/kaarten/vic-to-the-future-taccacagctttctacatgttgtacactgcaggaccatgaaaacggaaccgtgtcaacctaagc/)

## Text

Iets nieuws beginnen zonder een besluit te nemen over bestaand werk is geen flexibiliteit. Het is alleen meer werk tegelijk.

Een nieuw model is nieuws. Nog geen strategie.

## Presentation

decision-status

## Process

- PLAN v1.0
- BEOORDELING
- PLAN v1.1

## Decisions

| label | text |
| --- | --- |
| DOORGAAN | De belangrijkste aannames kloppen nog. |
| AANPASSEN | Het doel blijft relevant, maar product of uitvoering verandert. |
| STOPPEN | Het probleem, voordeel of onderscheid is verdwenen. |

## Body markdown

Inhoudskaart 4 van 4 uit de stapel **Vic to the Future**.

## Relations

| type | id |
| --- | --- |
| topic | tp:systems |

## Representations

- **html:** https://vicboomer.com/kaarten/vic-to-the-future-step-4-aattgcaagaattagttaggtatccaccgcatcagttaaaaaacggaaccgttagcgtgaacct/
- **markdown:** https://vicboomer.com/kaarten/vic-to-the-future-step-4-aattgcaagaattagttaggtatccaccgcatcagttaaaaaacggaaccgttagcgtgaacct/card.md
- **machine_index:** https://vicboomer.com/llms.txt
- **print:** https://vicboomer.com/kaarten/vic-to-the-future-step-4-aattgcaagaattagttaggtatccaccgcatcagttaaaaaacggaaccgttagcgtgaacct/werkkaart.pdf

The canonical HTML page and card.json are the authoritative representations.